FromConfig adapters

TL;DR: the FromConfig adapters take their data from an array written into config.json, for small datasets or for features an API handed you. There are three: FromConfigAdapter for features, FromConfigSequenceAdapter for sequence, and FromConfigRegionsAdapter for refNames and lengths with no sequence.

FromConfigAdapter

Each entry in features needs refName, start, end and a unique uniqueId; type, name and any other attribute are optional and readable from a jexl callback. It works under any feature track type:

Config file CLI (add-track-json) JBrowse Desktop

{
  "type": "FeatureTrack",
  "trackId": "inline_features",
  "name": "Inline features",
  "assemblyNames": ["volvox"],
  "adapter": {
    "type": "FromConfigAdapter",
    "features": [
      {
        "refName": "ctgA",
        "uniqueId": "feature1",
        "start": 190,
        "end": 250,
        "type": "gene",
        "name": "MyGene"
      },
      {
        "refName": "ctgA",
        "uniqueId": "feature2",
        "start": 300,
        "end": 400,
        "type": "mRNA",
        "name": "MyTranscript"
      }
    ]
  }
}

jbrowse add-track-json '{
  "type": "FeatureTrack",
  "trackId": "inline_features",
  "name": "Inline features",
  "assemblyNames": ["volvox"],
  "adapter": {
    "type": "FromConfigAdapter",
    "features": [
      {
        "refName": "ctgA",
        "uniqueId": "feature1",
        "start": 190,
        "end": 250,
        "type": "gene",
        "name": "MyGene"
      },
      {
        "refName": "ctgA",
        "uniqueId": "feature2",
        "start": 300,
        "end": 400,
        "type": "mRNA",
        "name": "MyTranscript"
      }
    ]
  }
}'

In JBrowse Desktop, or in any running JBrowse Web session, open a view on this track’s assembly, then File → Open track..., choose Add track from pasted JSON, and paste:

{
  "type": "FeatureTrack",
  "trackId": "inline_features",
  "name": "Inline features",
  "assemblyNames": ["volvox"],
  "adapter": {
    "type": "FromConfigAdapter",
    "features": [
      {
        "refName": "ctgA",
        "uniqueId": "feature1",
        "start": 190,
        "end": 250,
        "type": "gene",
        "name": "MyGene"
      },
      {
        "refName": "ctgA",
        "uniqueId": "feature2",
        "start": 300,
        "end": 400,
        "type": "mRNA",
        "name": "MyTranscript"
      }
    ]
  }
}

FromConfigSequenceAdapter

The sequence adapter of an assembly, with each feature's seq holding the bases for its region:

{
  "name": "inline_assembly",
  "sequence": {
    "adapter": {
      "type": "FromConfigSequenceAdapter",
      "features": [
        {
          "refName": "SEQUENCE_1",
          "uniqueId": "firstId",
          "start": 0,
          "end": 33,
          "seq": "CCAAGATCTAAGATGTCAACACCTATCTGCTCA"
        },
        {
          "refName": "SEQUENCE_2",
          "uniqueId": "secondId",
          "start": 0,
          "end": 44,
          "seq": "CCGAACCACAGGCCTATGTTACCATTGGAAAGCTCACCTTCCCG"
        }
      ]
    }
  }
}

FromConfigRegionsAdapter

Names and lengths with no sequence, so a view can navigate and tracks can draw against an assembly whose FASTA you do not have or do not want to load. Same place in the config, and each feature is just an interval:

{
  "name": "regions_only",
  "sequence": {
    "adapter": {
      "type": "FromConfigRegionsAdapter",
      "features": [
        { "uniqueId": "ctgA", "refName": "ctgA", "start": 0, "end": 50000 },
        { "uniqueId": "ctgB", "refName": "ctgB", "start": 0, "end": 6079 }
      ]
    }
  }
}

The same thing from a file is a ChromSizesAdapter over a .chrom.sizes.

FromConfig adapters